Source code for bioconvert.sam2paf

###########################################################################
# Bioconvert is a project to facilitate the interconversion               #
# of life science data from one format to another.                        #
#                                                                         #
# Copyright © 2018-2022  Institut Pasteur, Paris and CNRS.                #
#                                                                         #
# bioconvert is free software: you can redistribute it and/or modify      #
# it under the terms of the GNU General Public License as published by    #
# the Free Software Foundation, either version 3 of the License, or       #
# (at your option) any later version.                                     #
#                                                                         #
# bioconvert is distributed in the hope that it will be useful,           #
# but WITHOUT ANY WARRANTY; without even the implied warranty of          #
# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the           #
# GNU General Public License for more details.                            #
#                                                                         #
# You should have received a copy of the GNU General Public License       #
# along with this program (COPYING file).                                 #
# If not, see <http://www.gnu.org/licenses/>.                             #
#                                                                         #
# Repository: https://github.com/bioconvert/bioconvert                    #
# Documentation: http://bioconvert.readthedocs.io                         #
###########################################################################

""""Convert :term:`CRAM` to :term:`BAM` format"""
import re

import colorlog

from bioconvert import ConvBase
from bioconvert.core.decorators import requires_nothing

logger = colorlog.getLogger(__name__)


[docs] class SAM2PAF(ConvBase): """Convert :term:`SAM` file to :term:`PAF` file The :term:`SAM` and :term:`PAF` formats are described in the :ref:`formats` section. Description: The header of the SAM file (lines starting with @) are dropped. However, the length of the target is retrieved from the @SQ line that must be present. Consider this SAM file with two alignements only. One is aligned on the target (first) while the other is not (indicated by the ``*`` characters):: @SQ SN:ENA|K01711|K01711.1 LN:15894 @PG ID:minimap2 PN:minimap2 VN:2.5-r572 CL:minimap2 -a measles.fa Hm2_GTGAAA_L005_R1_001.fastq.gz HISEQ:426:C5T65ACXX:5:2302:1943:2127 0 ENA|K01711|K01711.1 448 60 101M * 00 CTTACCTTCGCATCAAGAGGTACCAACATGGAGGATGAGGCGGACCAATACTTTTCACATGATGATCCAATTAGTAGTGATCAATCCAGGTTCGGATGGTT BCCFFFFFHHHHHIIJJJJJJIIJJJJJJJJFHIHIJJJIJIIIIGHFFFFFFEEEEEEEDDDDDFDDDDDDDDD>CDDEDEEDDDDDDCCDDDDDDDDCD NM:i:0 ms:i:202 AS:i:202 nn:i:0 tp:A:P cm:i:14 s1:i:94 s2:i:0 HISEQ:426:C5T65ACXX:5:2302:4953:2090 4 * 0 0 * * 0 0 AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAACAACCAAAAAGAGACGAACAA CCCFFDDFAFFBHJHGGGIHIJBGGHIIJJJJJJJHGEIJGIFIIIHCBGHIJIIIIIJJHHHHEF@D@=;=,0)0&5&))+(((+((((&+(((()&&)( The equivalent PAF file is :: HISEQ:426:C5T65ACXX:5:2302:1943:2127 101 0 101 + ENA|K01711|K01711.1 15894 447 548 101 101 60 NM:i:0 ms:i:202 AS:i:202 nn:i:0 tp:A:P cm:i:14 s1:i:94 s2:i:0 cg:Z:101M In brief, the sequences are dropped. The final file is therefore smaller. Extra fields (starting from NM:i:0) can be dropped or kept using the keep_extra_field argument. Alignement with ``*`` characters are dropped. The first line (@SQ) is used to retrieve the length of the contigs that is stored in the PAF file (column 6). The 12 compulsary PAF fields are: ====== ======== =========================================== Col Type Description ====== ======== =========================================== 1 string Query sequence name 2 int Query sequence length 3 int Query start (0-based) 4 int Query end (0-based) 5 char Relative strand: "+" or "-" 6 string Target sequence name 7 int Target sequence length 8 int Target start on original strand (0-based) 9 int Target end on original strand (0-based) 10 int Number of residue matches 11 int Alignment block length 12 int Mapping quality (0-255; 255 for missing) ====== ======== =========================================== For developesr: Get the measles data from Sequana library (2 paired fastq files):: minimap2 measles.fa R1.fastq > approx-mapping.paf You can ask minimap2 to generate CIGAR at the cg tag of PAF with: minimap2 -c measles.fa R1.fastq > alignment.paf or to output alignments in the SAM format:: minimap2 -a measles.fa R1.fastq > alignment.sam The SAM lines must contains 11 positional element and the NM:i and nn:i fields (see example above). """ #: Default value _default_method = "python" def __init__(self, infile, outfile, *args, **kargs): """.. rubric:: constructor :param str infile: input SAM file :param str outfile: output PAF filename :reference: This function is a direct translation of https://github.com/lh3/miniasm/blob/master/misc/sam2paf.js (Dec. 2017). """ super(SAM2PAF, self).__init__(infile, outfile, *args, **kargs)
[docs] @requires_nothing def _method_python(self, *args, **kwargs): """Internal method""" pattern = r"(\d+)([MIDSHNX=])" extra_fields = kwargs.get("extra_fields", "SAM") # TODO: what is this ? pri_only = kwargs.get("pri_only", True) skipped = 0 reference_lengths = {} with open(self.infile, "r") as fin: with open(self.outfile, "w") as fout: for lineno, line in enumerate(fin.readlines()): if line.startswith("@"): if line.startswith("@SQ"): match = re.findall(r"\tSN:(\S+)", line) name = match[0] if len(match) else "unknown_reference" match = re.findall(r"\tLN:(\d+)", line) if len(match) == 1: reference_lengths[name] = int(match[0]) else: raise ValueError( "Could not parse SQ line to extract the length " "(LN: field missing maybe ?)" ) continue t = line.split() flag = int(t[1]) if t[9] != "*" and t[10] != "*" and len(t[9]) != len(t[10]): raise ValueError( "ERROR at line " + str(lineno) + ":inconsistent SEQ and QUAL lengths - " + str(len(t[9])) + " != " + str(len(t[10])) ) if t[2] == "*" or (flag & 4): skipped += 1 continue # if flag is 256 and pri_only, we skip the alignment if pri_only and (flag & 0x100): continue # Get the reference length for this alignment if t[2] in reference_lengths: tlen = reference_lengths[t[2]] else: raise KeyError("can't find the length of contig {}".format(t[2])) # The reference is known but the length is not if tlen == -1: raise ValueError( "ERROR at line " + str(lineno) + ": can't find the length of contig " + str(t[2]) ) # TODO explain what are the nn and NM tags match = re.findall(r"\tnn:i:(\d+)", line) if match: nn = int(match[0]) else: nn = 0 match = re.findall(r"\tNM:i:(\d+)", line) if match: NM = int(match[0]) have_NM = True else: NM = 0 have_NM = False NM += nn # See sequana.cigar for more information clip = [0, 0] I = [0, 0] # Insertion D = [0, 0] # Deletion M, N = 0, 0 # Matches ql, tl, mm = ( 0, 0, 0, ) ext_cigar = False n_cigar = 0 Zacc = "" for count, letter in re.findall(pattern, t[5]): l = int(count) if letter == "M": M += l ql += l tl += l ext_cigar = False Zacc += "{}M".format(count) elif letter == "I": I[0] += 1 I[1] += l ql += l Zacc += "{}I".format(count) elif letter == "D": D[0] += 1 D[1] += l tl += l Zacc += "{}D".format(count) elif letter == "N": N += l tl += l elif letter == "S": clip[0 if M == 0 else 1] = l ql += l elif letter == "H": clip[0 if M == 0 else 1] = l elif letter == "=": M += l ql += l tl += l ext_cigar = True elif letter == "X": M += l ql += l tl += l mm += l ext_cigar = True n_cigar += 1 prefix_msg = "at line {}: ".format(lineno) + "{}" if n_cigar > 65535: logger.warning(prefix_msg.format(str(n_cigar) + " CIGAR operations")) if tl + int(t[3]) - 1 > tlen: logger.warning(prefix_msg.format("alignment end " "position larger than ref length; skipped")) continue if t[9] != "*" and len(t[9]) != ql: logger.warning( prefix_msg.format( " SEQ length inconsistent with CIGAR(" + str(len(t[9])) + " != " + str(ql) + "); skipped" ) ) continue if have_NM is False or ext_cigar: NM = I[1] + D[1] + mm if NM < I[1] + D[1] + mm: logger.warning( prefix_msg.format( " NM is less than the total number of gaps (" + str(NM) + " < " + str(I[1] + D[1] + mm) + ")" ) ) NM = I[1] + D[1] + mm # extra information to store in the PAF after the 12 # extra field from original code. The insert and # deletions (io/in and do/di) and mm is the number of other # substitutions ? NM -I[1] -D[1] extra = [ "mm:i:" + str(NM - I[1] - D[1]), "io:i:" + str(I[0]), "in:i:" + str(I[1]), "do:i:" + str(D[0]), "dn:i:" + str(D[1]), ] match = M - (NM - I[1] - D[1]) blen = M + I[1] + D[1] qlen = M + I[1] + clip[0] + clip[1] # What does flag 16 means ? if flag & 16: qs = clip[1] qe = qlen - clip[0] else: qs = clip[0] qe = qlen - clip[1] ts = int(t[3]) - 1 te = ts + M + D[1] + N # WARNING: difference with sam2paf.js : we add and substract nn # from match and blen to agree with the output SAM file # generated by minimap2 # The 12 compulsary fields to have a valid PAF format a = [ t[0], qlen, qs, qe, "-" if flag & 16 else "+", t[2], tlen, ts, te, match + nn, blen - nn, t[4], ] # cast to string and save in file a = [str(x) for x in a] # What extra fields do we want to add ? # original fields found in the SAM file ? if extra_fields == "SAM" and len(t) > 11: fout.write("\t".join(a) + "\t" + "\t".join(t[11:]) + "\tcg:Z:{}\n".format(Zacc)) elif extra_fields == "summary": fout.write("\t".join(a) + "\t" + "\t".join(extra) + "\n") elif extra_fields is None: fout.write("\t".join(a) + "\n") self.skipped = skipped
# @requires(external_binaries=["k8", "paftools"]) # def _method_paftools(self, *args, **kwargs): # cmd = "paftools sam2paf {} > {}".format(self.infile, self.outfile) # self.execute(cmd)